EMBOSS: merger


Program merger

Function

Merge two overlapping nucleic acid sequences

Description

This joins two overlapping nucleic acid sequences into one merged sequence.

It uses a global alignment algorithm (Needleman & Wunsch) to optimally align the sequences and then it creates the merged sequence from the alignment. When there is a mismatch in the alignment between the two sequences, the correct base to include in the resulting sequence is chosen by using the base from the sequence which has the best local sequence quality score. The following heuristic is used to find the sequence quality score:

If one of the bases is a 'N', then the other sequence's base is used, else:

A window size around the disputed base is used to find the local quality score. This window size is increased from 5, to 10 to 20 bases or until there is a clear decision on the best choice. If there is no best choice after using a window of 20, then the base in the first sequence is used.

To calculate the quality of a window of a sequence around a base:

N.B. This heavily discriminates against the iffy bits at the end of sequence reads.

This program was originally written to aid in the reconstruction of mRNA sequences which had been sequenced from both ends as a 5' and 3' EST (cDNA). eg. joining two reads produced by primer walking sequencing.

Care should be taken to reverse one of the sequences (e.g. using the qualifier '-sreverse2') if this is required to get them both in the correct orientation.

Because it uses a Needleman & Wunsch alignment the required memory may be greater than the available memory when attempting to merge large (cosmid-sized or greater) sequences.

The gap open and gap extension penalties have been set at a higher level than is usual (50 and 5). This was experimentally determined to give the best results with a set of poor quality EST test sequences.

Usage

Here is a sample session with merger.

% merger
Input sequence: embl:eclacy
Second sequence: embl:eclaca
Output sequence [eclacy.fasta]: 
Output file [stdout]: 

Global: ECLACY vs ECLACA
Score: 795.00

ECLACY          1     ttccagctgagcgccggtcgctaccattaccagttggtctggtgt 45   
                                                                   
ECLACA                                                              


.................... until ......................


ECLACY          1306  agcggccccggcccgctttccctgctgcgtcgtcaggtgaatgaa 1350 
                                                          |||||||||
ECLACA          1                                         gtgaatgaa 9    

ECLACY          1351  gtcgcttaagcaatcaatgtcggatgcggcgcgacgcttatccga 1395 
                      |||||||||||||||||||||||||||||||||||||||||||||
ECLACA          10    gtcgcttaagcaatcaatgtcggatgcggcgcgacgcttatccga 54   

ECLACY          1396  ccaacatatcataacggagtgatcgcattgaacatgccaatgacc 1440 
                      |||||||||||||||||||||||||||||||||||||||||||||
ECLACA          55    ccaacatatcataacggagtgatcgcattgaacatgccaatgacc 99   

ECLACY          1441  gaaagaataagagcaggcaagctatttaccgatatgtgcgaaggc 1485 
                      |||||||||||||||||||||||||||||||||||||||||||||
ECLACA          100   gaaagaataagagcaggcaagctatttaccgatatgtgcgaaggc 144  

ECLACY          1486  ttaccggaaaaaaga                               1500 
                      |||||||||||||||                              
ECLACA          145   ttaccggaaaaaagacttcgtgggaaaacgttaatgtatgagttt 189  

ECLACY                                                              
                                                                   
ECLACA          190   aatcactcgcatccatcagaagttgaaaaaagagaaagcctgatt 234  

ECLACY                                                              
                                                                   

Typically, one of the sequences will need to be reverse-complemented to put it into the correct orientation to make it join. For example:

% merger file1.seq file2.seq -sreverse2 -out merged.seq

Command line arguments

   Mandatory qualifiers:
  [-seqa]              sequence   Sequence USA
  [-seqb]              sequence   Sequence USA
  [-outseq]            seqout     Output sequence USA
   -report             outfile    Output alignment and explanation

   Optional qualifiers:
   -datafile           matrixf    Matrix file
   -gapopen            float      Gap opening penalty
   -gapextend          float      Gap extension penalty

   Advanced qualifiers: (none)

Mandatory qualifiers Allowed values Default
[-seqa]
(Parameter 1)
Sequence USA Readable sequence Required
[-seqb]
(Parameter 2)
Sequence USA Readable sequence Required
[-outseq]
(Parameter 3)
Output sequence USA Writeable sequence <sequence>.format
-report Output alignment and explanation Output file stdout
Optional qualifiers Allowed values Default
-datafile Matrix file Comparison matrix file in EMBOSS data path EBLOSUM62 for protein
EDNAMAT for DNA
-gapopen Gap opening penalty Number from 1.000 to 100.000 50.0
-gapextend Gap extension penalty Number from 0.100 to 10.000 5
Advanced qualifiers Allowed values Default
(none)

Input file format

Output file format

The output sequence file contains the joined sequence, by default in FASTA format. Where there is a mismatch in the alignment, the chosen base is written to the output sequence in uppercase.

The output report file contains descriptions of the positions where there is a mismatch in the alignment and shows the alignment. Where there is a mismatch in the alignment, the chosen base is written in uppercase.

An example report file showing mismatches follows:


# j1 position base           j2 position base        Using
        12      'G'             1       'a'             'G'
        13      'C'             2       'a'             'C'
        14      'G'             3       'a'             'G'
        16      'T'             5       'a'             'T'
        20      'T'             9       'g'             'T'
        23      'G'             12      'c'             'G'
        24      'C'             13      'g'             'C'
        41      'G'             30      't'             'G'
        57      't'             46      'C'             'C'
Global: j1 vs j2
Score: 188.00

j1              1        gtatggtcgatGCGaTgcgTatGCtGacgttAgcggcggcGatat 45      
                                       | ||| ||  | ||||| |||||||| ||||
j2              1                   aaaaagcggatcgtnacgttngcggcggctatat 34      

j1              46       attgcgagctatgatgctnatcgtngc                   72      
                         ||||||||||| |||||| ||||| ||                  
j2              35       attgcgagctaCgatgctGatcgtAgcgtacgttgaaagctacta 79      

j1                                                                     
                                                 
j2              80       ctatgctgtgctagctgacgtagc                      103     

Data files

Notes

References

Warnings

Diagnostic Error Messages

Exit status

Known bugs

See also

Program nameDescription
cutseqRemoves a specified section from a sequence
descseqAlter the name or description of a sequence
est2genomeAlign EST and genomic DNA sequences
extractseqExtract regions from a sequence
maskfeatMask off features of a sequence
maskseqMask off regions of a sequence
megamergerMerge two large overlapping nucleic acid sequences
newseqType in a short new sequence
noreturnRemoves carriage return from ASCII files
nthseqWrites one sequence from a multiple set of sequences
pasteseqInsert one sequence into another
revseqReverse and complement a sequence
splitterSplit a sequence into (overlapping) smaller sequences
trimseqTrim ambiguous bits off the ends of sequences
vectorstripStrips out DNA between a pair of vector sequences

Author(s)

This application was written by Gary Williams (gwilliam@hgmp.mrc.ac.uk)

History

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments