![]() |
EMBOSS: stssearch |
This reads in one or more sequences to be searched. For each pair of primers, this looks for exact matches between a the primers and the query sequence in either orientation.
Any matches found will be reported. Only one primer need match.
% stssearch Input sequence(s): embl:eclac* Primer file: lac.primers
Mandatory qualifiers: [-sequences] seqall Sequence database USA [-primers] infile Primer file [-out] outfile Output file name Optional qualifiers: (none) Advanced qualifiers: (none) |
Mandatory qualifiers | Allowed values | Default | |
---|---|---|---|
[-sequences] (Parameter 1) |
Sequence database USA | Readable sequence(s) | Required |
[-primers] (Parameter 2) |
Primer file | Input file | Required |
[-out] (Parameter 3) |
Output file name | Output file | <sequence>.stssearch |
Optional qualifiers | Allowed values | Default | |
(none) | |||
Advanced qualifiers | Allowed values | Default | |
(none) |
PrimA ACCAGACACCCATCAACAG TATTTATGCCAGCCAGCCAG PrimB CGAAAGAATAAGAGCAGGCAAG GTAAGAGAAATAGACAGGCGG PrimC CGTCAGTATCCCCGTTTACAG TATCGCCAAAATCACCGCC PrimD AATACGCAAACCGCCTCTCC TTATCCGCTCACAATTCCACAC PrimE AATACGCAAACCGCCTCTCC CACAACCCGCTCACAATTCCA
It consists of three columns separated by tabs or spaces.
The first column is the name of the primer pair.
The second column is the sequence of the first primer.
The third column is the sequence of the second primer.
ECLAC: PrimA PrimerA matched at 532 ECLAC: (rev) PrimA PrimerB matched at 689 ECLAC: PrimB PrimerA matched at 5743 ECLAC: (rev) PrimB PrimerB matched at 5942 ECLAC: PrimC PrimerA matched at 2954 ECLAC: (rev) PrimC PrimerB matched at 3069 ECLAC: PrimD PrimerA matched at 1074 ECLAC: (rev) PrimD PrimerB matched at 1261 ECLAC: PrimE PrimerA matched at 1074 ECLACA: PrimB PrimerA matched at 98 ECLACA: (rev) PrimB PrimerB matched at 297 ECLACI: PrimA PrimerA matched at 484 ECLACI: (rev) PrimA PrimerB matched at 641 ECLACI: PrimD PrimerA matched at 1026 ECLACI: PrimE PrimerA matched at 1026 ECLACY: PrimB PrimerA matched at 1439 ECLACZ: PrimC PrimerA matched at 1668 ECLACZ: (rev) PrimC PrimerB matched at 1783
This consists of one line per match. This consists of:
Program name | Description |
---|---|
dotmatcher | Displays a thresholded dotplot of two sequences |
polydot | Displays all-against-all dotplots of a set of sequences |
prima | Selects primers for PCR and DNA amplification |
primersearch | Searches DNA sequences for matches with primer pairs |
seqmatchall | Does an all-against-all comparison of a set of sequences |
supermatcher | Finds a match of a large sequence against one or more sequences |
wordmatch | Finds all exact matches of a given size between 2 sequences |
If you want something that only reports matches of both primer pairs and can find mismatches, use primersearch.