![]() |
EMBOSS: primer3 |
The Whitehead program must be set up and on the path in order for primer3 to find and run it.
Primer3 picks primers for PCR reactions, considering as criteria:
All of these criteria are user-specifiable as constraints.
primer3 can also pick hybridisation oligos that are internal to the product.
Techniques for avoiding problems include a thorough understanding of possible vector contaminants and cloning artifacts coupled with database searches using blast, fasta, or other similarity searching program to screen for vector contaminants and possible repeats. Repbase (J. Jurka, A.F.A. Smit, C. Pethiyagoda, and others, 1995-1996, ftp://ncbi.nlm.nih.gov/repository/repbase) is an excellent source of repeat sequences and pointers to the literature. Primer3 now allows you to screen candidate oligos against a Mispriming Library (or a Mishyb Library in the case of internal oligos).
Sequence quality can be controlled by manual trace viewing and quality clipping or automatic quality clipping programs. Low- quality bases should be changed to N's or can be made part of Excluded Regions. The beginning of a sequencing read is often problematic because of primer peaks, and the end of the read often contains many low-quality or even meaningless called bases. Therefore when picking primers from single-pass sequence it is often best to use the INCLUDED_REGION parameter to ensure that Primer3 chooses primers in the high quality region of the read.
In addition, Primer3 takes as input a Sequence Quality list for use with those base calling programs
(e.g. Phred, Bass/Grace, Trout) that output this information.
Try setting the '-explain' option.
% primer3 em:hsfau1 hsfau.primer3 -explain
Mandatory qualifiers: [-sequence] seqall The sequence from which to choose primers. The sequence must be presented 5' to 3' [-outfile] outfile Output file name Optional qualifiers (* if not always prompted): -task list Tell Primer3 what task to perform. Legal values are 0: 'Pick PCR primers', 1: 'Pick PCR primers and hybridization probe', 2: 'Pick forward primer only', 3: 'Pick reverse primer only', 4: 'Pick hybridization probe only'. The tasks should be self explanatory. Briefly, an 'internal oligo' is intended to be used as a hybridization probe (hyb probe) to detect the PCR product after amplification. -numreturn integer The maximum number of primer pairs to return. Primer pairs returned are sorted by their 'quality', in other words by the value of the objective function (where a lower number indicates a better primer pair). Caution: setting this parameter to a large value will increase running time. -includedregion range A sub-region of the given sequence in which to pick primers. For example, often the first dozen or so bases of a sequence are vector, and should be excluded from consideration. The value for this parameter has the form (start),(end) where (start) is the index of the first base to consider, and (end) is the last in the primer-picking region. -target range If one or more Targets is specified then a legal primer pair must flank at least one of them. A Target might be a simple sequence repeat site (for example a CA repeat) or a single-base-pair polymorphism. The value should be a space-separated list of (start),(end) pairs where (start) is the index of the first base of a Target, and (end) is the last E.g. 50,51 requires primers to surround the 2 bases at positions 50 and 51. -excludedregion range Primer oligos may not overlap any region specified in this tag. The associated value must be a space-separated list of (start),(end) pairs where (start) is the index of the first base of the excluded region, and and (end) is the last. This tag is useful for tasks such as excluding regions of low sequence quality or for excluding regions containing repetitive elements such as ALUs or LINEs. E.g. 401,407 68,70 forbids selection of primers in the 7 bases starting at 401 and the 3 bases at 68. -forwardinput string The sequence of a forward primer to check and around which to design reverse primers and optional internal oligos. Must be a substring of SEQUENCE. -reverseinput string The sequence of a reverse primer to check and around which to design forward primers and optional internal oligos. Must be a substring of the reverse strand of SEQUENCE. * -gcclamp integer Require the specified number of consecutive Gs and Cs at the 3' end of both the forward and reverse primer. (This parameter has no effect on the internal oligo if one is requested.) * -osize integer Optimum length (in bases) of a primer oligo. Primer3 will attempt to pick primers close to this length. * -minsize integer Minimum acceptable length of a primer. Must be greater than 0 and less than or equal to MAX-SIZE. * -maxsize integer Maximum acceptable length (in bases) of a primer. Currently this parameter cannot be larger than 35. This limit is governed by the maximum oligo size for which Primer3's melting-temperature is valid. * -otm float Optimum melting temperature(Celsius) for a primer oligo. Primer3 will try to pick primers with melting temperatures are close to this temperature. The oligo melting temperature formula in Primer3 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 12, pp 6409-6412 and Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for background discussion. * -mintm float Minimum acceptable melting temperature(Celsius) for a primer oligo. * -maxtm float Maximum acceptable melting temperature(Celsius) for a primer oligo. * -maxdifftm float Maximum acceptable (unsigned) difference between the melting temperatures of the forward and reverse primers. * -ogcpercent float Primer optimum GC percent. * -mingc float Minimum allowable percentage of Gs and Cs in any primer. * -maxgc float Maximum allowable percentage of Gs and Cs in any primer generated by Primer. * -saltconc float The millimolar concentration of salt (usually KCl) in the PCR. Primer3 uses this argument to calculate oligo melting temperatures. * -dnaconc float The nanomolar concentration of annealing oligos in the PCR. Primer3 uses this argument to calculate oligo melting temperatures. The default (50nM) works well with the standard protocol used at the Whitehead/MIT Center for Genome Research--0.5 microliters of 20 micromolar concentration for each primer oligo in a 20 microliter reaction with 10 nanograms template, 0.025 units/microliter Taq polymerase in 0.1 mM each dNTP, 1.5mM MgCl2, 50mM KCl, 10mM Tris-HCL (pH 9.3) using 35 cycles with an annealing temperature of 56 degrees Celsius. This parameter corresponds to 'c' in Rychlik, Spencer and Rhoads' equation (ii) (Nucleic Acids Research, vol 18, num 12) where a suitable value (for a lower initial concentration of template) is 'empirically determined'. The value of this parameter is less than the actual concentration of oligos in the reaction because it is the concentration of annealing oligos, which in turn depends on the amount of template (including PCR product) in a given cycle. This concentration increases a great deal during a PCR; fortunately PCR seems quite robust for a variety of oligo melting temperatures. See ADVICE FOR PICKING PRIMERS. * -maxpolyx integer The maximum allowable length of a mononucleotide repeat in a primer, for example AAAAAA. * -productosize integer The optimum size for the PCR product. 0 indicates that there is no optimum product size. * -productsizerange range The associated values specify the lengths of the product that the user wants the primers to create, and is a space separated list of elements of the form (x)-(y) where an (x)-(y) pair is a legal range of lengths for the product. For example, if one wants PCR products to be between 100 to 150 bases (inclusive) then one would set this parameter to 100-150. If one desires PCR products in either the range from 100 to 150 bases or in the range from 200 to 250 bases then one would set this parameter to 100-150 200-250. Primer3 favors ranges to the left side of the parameter string. Primer3 will return legal primers pairs in the first range regardless the value of the objective function for these pairs. Only if there are an insufficient number of primers in the first range will Primer3 return primers in a subsequent range. * -productotm float The optimum melting temperature for the PCR product. 0 indicates that there is no optimum temperature. * -productmintm float The minimum allowed melting temperature of the amplicon. Please see the documentation on the maximum melting temperature of the product for details. * -productmaxtm float The maximum allowed melting temperature of the amplicon. Product Tm is calculated using the formula from Bolton and McCarthy, PNAS 84:1390 (1962) as presented in Sambrook, Fritsch and Maniatis, Molecular Cloning, p 11.46 (1989, CSHL Press). Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) - 600/length Where [Na+} is the molar sodium concentration, (%GC) is the percent of Gs and Cs in the sequence, and length is the length of the sequence. A similar formula is used by the prime primer selection program in GCG http://www.gcg.com), which instead uses 675.0/length in the last term (after F. Baldino, Jr, M.-F. Chesselet, and M.E. Lewis, Methods in Enzymology 168:766 (1989) eqn (1) on page 766 without the mismatch and formamide terms). The formulas here and in Baldino et al. assume Na+ rather than K+. According to J.G. Wetmur, Critical Reviews in BioChem. and Mol. Bio. 26:227 (1991) 50 mM K+ should be equivalent in these formulae to .2 M Na+. Primer3 uses the same salt concentration value for calculating both the primer melting temperature and the oligo melting temperature. If you are planning to use the PCR product for hybridization later this behavior will not give you the Tm under hybridization conditions. * -oligoexcludedregion range Middle oligos may not overlap any region specified by this tag. The associated value must be a space-separated list of (start),(end) pairs, where (start) is the index of the first base of an excluded region, and (end) is the last. Often one would make Target regions excluded regions for internal oligos. * -oligoinput string The sequence of an internal oligo to check and around which to design forward and reverse primers. Must be a substring of SEQUENCE. * -oligoosize integer Optimum length (in bases) of an internal oligo. Primer3 will attempt to pick primers close to this length. * -oligominsize integer Minimum acceptable length of an internal oligo. Must be greater than 0 and less than or equal to INTERNAL-OLIGO-MAX-SIZE. * -oligomaxsize integer Maximum acceptable length (in bases) of an internal oligo. Currently this parameter cannot be larger than 35. This limit is governed by maximum oligo size for which Primer3's melting-temperature is valid. * -oligootm float Optimum melting temperature (Celsius) for an internal oligo. Primer3 will try to pick oligos with melting temperatures that are close to this temperature. The oligo melting temperature formula in Primer3 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 12, pp 6409-6412 and Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for background discussion. * -oligomintm float Minimum acceptable melting temperature(Celsius) for an internal oligo. * -oligomaxtm float Maximum acceptable melting temperature (Celsius) for an internal oligo. * -oligoogcpercent float Internal oligo optimum GC percent. * -oligomingc float Minimum allowable percentage of Gs and Cs in an internal oligo. * -oligomaxgc float Maximum allowable percentage of Gs and Cs in any internal oligo generated by Primer. * -oligosaltconc float The millimolar concentration of salt (usually KCl) in the hybridization. Primer3 uses this argument to calculate internal oligo melting temperatures. * -oligodnaconc float The nanomolar concentration of annealing internal oligo in the hybridization. * -oligoselfany float The maximum allowable local alignment score when testing an internal oligo for (local) self-complementarity. Local self-complementarity is taken to predict the tendency of oligos to anneal to themselves The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment 5' ATCGNA 3' || | | 3' TA-CGT 5' is allowed (and yields a score of 1.75), but the alignment 5' ATCCGNA 3' || | | 3' TA--CGT 5' is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos. * -oligoselfend float The maximum allowable 3'-anchored global alignment score when testing a single oligo for self-complementarity. The scoring system is as for the Maximum Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate oligos, Primer assumes that the sequence from which to choose oligos is presented 5' to 3'. INTERNAL-OLIGO-SELF-END is meaningless when applied to internal oligos used for hybridization-based detection, since primer-dimer will not occur. We recommend that INTERNAL-OLIGO-SELF-END be set at least as high as INTERNAL-OLIGO-SELF-ANY. * -oligomaxpolyx integer The maximum allowable length of an internal oligo mononucleotide repeat, for example AAAAAA. Advanced qualifiers: -explainflag bool If this flag is non-0, produce LEFT-EXPLAIN, RIGHT-EXPLAIN, and INTERNAL-OLIGO-EXPLAIN output tags, which are intended to provide information on the number of oligos and primer pairs that Primer3 examined, and statistics on the number discarded for various reasons. -fileflag bool If the associated value is non-0, then Primer3 creates two output files for each input SEQUENCE. File (sequence-id).for lists all acceptable forward primers for (sequence-id), and (sequence-id).rev lists all acceptable reverse primers for (sequence-id), where (sequence-id) is the value of the SEQUENCE-ID tag (which must be supplied). In addition, if the input tag TASK is 1 or 4, Primer3 produces a file (sequence-id).int, which lists all acceptable internal oligos. -firstbaseindex integer This parameter is the index of the first base in the input sequence. For input and output using 1-based indexing (such as that used in GenBank and to which many users are accustomed) set this parameter to 1. For input and output using 0-based indexing set this parameter to 0. (This parameter also affects the indexes in the contents of the files produced when the primer file flag is set.) -pickanyway bool If true pick a primer pair even if LEFT-INPUT, RIGHT-INPUT, or INTERNAL-OLIGO-INPUT violates specific constraints. -mispriminglibrary infile The name of a file containing a nucleotide sequence library of sequences to avoid amplifying (for example repetitive sequences, or possibly the sequences of genes in a gene family that should not be amplified.) The file must be in (a slightly restricted) FASTA format (W. B. Pearson and D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]); we briefly discuss the organization of this file below. If this parameter is specified then Primer3 locally aligns each candidate primer against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds MAX-MISPRIMING. (The maximum value of the weight is arbitrarily set to 100.0.) Each sequence entry in the FASTA-format file must begin with an 'id line' that starts with '>'. The contents of the id line is 'slightly restricted' in that Primer3 parses everything after any optional asterisk ('*') as a floating point number to use as the weight mentioned above. If the id line contains no asterisk then the weight defaults to 1.0. The alignment scoring system used is the same as for calculating complementarity among oligos (e.g. SELF-ANY). The remainder of an entry contains the sequence as lines following the id line up until a line starting with '>' or the end of the file. Whitespace and newlines are ignored. Characters 'A', 'T', 'G', 'C', 'a', 't', 'g', 'c' are retained and any other character is converted to 'N' (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to 'N'). There are no restrictions on line length. An empty value for this parameter indicates that no repeat library should be used. -maxmispriming float The maximum allowed weighted similarity with any sequence in MISPRIMING-LIBRARY. -pairmaxmispriming float The maximum allowed sum of weighted similarities of a primer pair (one similarity for each primer) with any single sequence in MISPRIMING-LIBRARY. -numnsaccepted integer Maximum number of unknown bases (N) allowable in any primer. -selfany float The maximum allowable local alignment score when testing a single primer for (local) self-complementarity and the maximum allowable local alignment score when testing for complementarity between forward and reverse primers. Local self-complementarity is taken to predict the tendency of primers to anneal to each other without necessarily causing self-priming in the PCR. The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment 5' ATCGNA 3' ...|| | | 3' TA-CGT 5' is allowed (and yields a score of 1.75), but the alignment 5' ATCCGNA 3' ...|| | | 3' TA--CGT 5' is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos. -selfend float The maximum allowable 3'-anchored global alignment score when testing a single primer for self-complementarity, and the maximum allowable 3'-anchored global alignment score when testing for complementarity between forward and reverse primers. The 3'-anchored global alignment score is taken to predict the likelihood of PCR-priming primer-dimers, for example 5' ATGCCCTAGCTTCCGGATG 3' .............||| ||||| ..........3' AAGTCCTACATTTAGCCTAGT 5' or 5' AGGCTATGGGCCTCGCGA 3' ...............|||||| ............3' AGCGCTCCGGGTATCGGA 5' The scoring system is as for the Maximum Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate primers and primer pairs, Primer assumes that the sequence from which to choose primers is presented 5' to 3'. It is nonsensical to provide a larger value for this parameter than for the Maximum (local) Complementarity parameter because the score of a local alignment will always be at least as great as the score of a global alignment. -maxendstability float The maximum stability for the five 3' bases of a forward or reverse primer. Bigger numbers mean more stable 3' ends. The value is the maximum delta G for duplex disruption for the five 3' bases as calculated using the nearest neighbor parameters published in Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Primer3 uses a completely permissive default value for backward compatibility (which we may change in the next release). Rychlik recommends a maximum value of 9 (Wojciech Rychlik, 'Selection of Primers for Polymerase Chain Reaction' in BA White, Ed., 'Methods in Molecular Biology, Vol. 15: PCR Protocols: Current Methods and Applications', 1993, pp 31-40, Humana Press, Totowa NJ). -oligomishyblibrary infile Similar to MISPRIMING-LIBRARY, except that the event we seek to avoid is hybridization of the internal oligo to sequences in this library rather than priming from them. The file must be in (a slightly restricted) FASTA format (W. B. Pearson and D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]); we briefly discuss the organization of this file below. If this parameter is specified then Primer3 locally aligns each candidate oligo against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds INTERNAL-OLIGO-MAX-MISHYB. (The maximum value of the weight is arbitrarily set to 12.0.) Each sequence entry in the FASTA-format file must begin with an 'id line' that starts with '>'. The contents of the id line is 'slightly restricted' in that Primer3 parses everything after any optional asterisk ('*') as a floating point number to use as the weight mentioned above. If the id line contains no asterisk then the weight defaults to 1.0. The alignment scoring system used is the same as for calculating complementarity among oligos (e.g. SELF-ANY). The remainder of an entry contains the sequence as lines following the id line up until a line starting with '>' or the end of the file. Whitespace and newlines are ignored. Characters 'A', 'T', 'G', 'C', 'a', 't', 'g', 'c' are retained and any other character is converted to 'N' (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to 'N'). There are no restrictions on line length. An empty value for this parameter indicates that no library should be used. -oligomaxmishyb float Similar to MAX-MISPRIMING except that this parameter applies to the similarity of candidate internal oligos to the library specified in INTERNAL-OLIGO-MISHYB-LIBRARY. General qualifiers: -help bool report command line options. More information on associated and general qualifiers can be found with -help -verbose |
Mandatory qualifiers | Allowed values | Default | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
[-sequence] (Parameter 1) |
The sequence from which to choose primers. The sequence must be presented 5' to 3' | Readable sequence(s) | Required | ||||||||||
[-outfile] (Parameter 2) |
Output file name | Output file | <sequence>.primer3 | ||||||||||
Optional qualifiers | Allowed values | Default | |||||||||||
-task | Tell Primer3 what task to perform. Legal values are 0: 'Pick PCR primers', 1: 'Pick PCR primers and hybridization probe', 2: 'Pick forward primer only', 3: 'Pick reverse primer only', 4: 'Pick hybridization probe only'. The tasks should be self explanatory. Briefly, an 'internal oligo' is intended to be used as a hybridization probe (hyb probe) to detect the PCR product after amplification. |
|
0 | ||||||||||
-numreturn | The maximum number of primer pairs to return. Primer pairs returned are sorted by their 'quality', in other words by the value of the objective function (where a lower number indicates a better primer pair). Caution: setting this parameter to a large value will increase running time. | Integer 0 or more | 5 | ||||||||||
-includedregion | A sub-region of the given sequence in which to pick primers. For example, often the first dozen or so bases of a sequence are vector, and should be excluded from consideration. The value for this parameter has the form (start),(end) where (start) is the index of the first base to consider, and (end) is the last in the primer-picking region. | Sequence range | full sequence | ||||||||||
-target | If one or more Targets is specified then a legal primer pair must flank at least one of them. A Target might be a simple sequence repeat site (for example a CA repeat) or a single-base-pair polymorphism. The value should be a space-separated list of (start),(end) pairs where (start) is the index of the first base of a Target, and (end) is the last E.g. 50,51 requires primers to surround the 2 bases at positions 50 and 51. | Sequence range | full sequence | ||||||||||
-excludedregion | Primer oligos may not overlap any region specified in this tag. The associated value must be a space-separated list of (start),(end) pairs where (start) is the index of the first base of the excluded region, and and (end) is the last. This tag is useful for tasks such as excluding regions of low sequence quality or for excluding regions containing repetitive elements such as ALUs or LINEs. E.g. 401,407 68,70 forbids selection of primers in the 7 bases starting at 401 and the 3 bases at 68. | Sequence range | full sequence | ||||||||||
-forwardinput | The sequence of a forward primer to check and around which to design reverse primers and optional internal oligos. Must be a substring of SEQUENCE. | Any string is accepted | An empty string is accepted | ||||||||||
-reverseinput | The sequence of a reverse primer to check and around which to design forward primers and optional internal oligos. Must be a substring of the reverse strand of SEQUENCE. | Any string is accepted | An empty string is accepted | ||||||||||
-gcclamp | Require the specified number of consecutive Gs and Cs at the 3' end of both the forward and reverse primer. (This parameter has no effect on the internal oligo if one is requested.) | Integer 0 or more | 0 | ||||||||||
-osize | Optimum length (in bases) of a primer oligo. Primer3 will attempt to pick primers close to this length. | Integer 1 or more | 20 | ||||||||||
-minsize | Minimum acceptable length of a primer. Must be greater than 0 and less than or equal to MAX-SIZE. | Integer 1 or more | 18 | ||||||||||
-maxsize | Maximum acceptable length (in bases) of a primer. Currently this parameter cannot be larger than 35. This limit is governed by the maximum oligo size for which Primer3's melting-temperature is valid. | Integer up to 35 | 27 | ||||||||||
-otm | Optimum melting temperature(Celsius) for a primer oligo. Primer3 will try to pick primers with melting temperatures are close to this temperature. The oligo melting temperature formula in Primer3 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 12, pp 6409-6412 and Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for background discussion. | Any integer value | 60.0 | ||||||||||
-mintm | Minimum acceptable melting temperature(Celsius) for a primer oligo. | Any integer value | 57.0 | ||||||||||
-maxtm | Maximum acceptable melting temperature(Celsius) for a primer oligo. | Any integer value | 63.0 | ||||||||||
-maxdifftm | Maximum acceptable (unsigned) difference between the melting temperatures of the forward and reverse primers. | Any integer value | 100.0 | ||||||||||
-ogcpercent | Primer optimum GC percent. | Any integer value | 50.0 | ||||||||||
-mingc | Minimum allowable percentage of Gs and Cs in any primer. | Any integer value | 20.0 | ||||||||||
-maxgc | Maximum allowable percentage of Gs and Cs in any primer generated by Primer. | Any integer value | 80.0 | ||||||||||
-saltconc | The millimolar concentration of salt (usually KCl) in the PCR. Primer3 uses this argument to calculate oligo melting temperatures. | Any integer value | 50.0 | ||||||||||
-dnaconc | The nanomolar concentration of annealing oligos in the PCR. Primer3 uses this argument to calculate oligo melting temperatures. The default (50nM) works well with the standard protocol used at the Whitehead/MIT Center for Genome Research--0.5 microliters of 20 micromolar concentration for each primer oligo in a 20 microliter reaction with 10 nanograms template, 0.025 units/microliter Taq polymerase in 0.1 mM each dNTP, 1.5mM MgCl2, 50mM KCl, 10mM Tris-HCL (pH 9.3) using 35 cycles with an annealing temperature of 56 degrees Celsius. This parameter corresponds to 'c' in Rychlik, Spencer and Rhoads' equation (ii) (Nucleic Acids Research, vol 18, num 12) where a suitable value (for a lower initial concentration of template) is 'empirically determined'. The value of this parameter is less than the actual concentration of oligos in the reaction because it is the concentration of annealing oligos, which in turn depends on the amount of template (including PCR product) in a given cycle. This concentration increases a great deal during a PCR; fortunately PCR seems quite robust for a variety of oligo melting temperatures. See ADVICE FOR PICKING PRIMERS. | Any integer value | 50.0 | ||||||||||
-maxpolyx | The maximum allowable length of a mononucleotide repeat in a primer, for example AAAAAA. | Integer 0 or more | 5 | ||||||||||
-productosize | The optimum size for the PCR product. 0 indicates that there is no optimum product size. | Integer 0 or more | 200 | ||||||||||
-productsizerange | The associated values specify the lengths of the product that the user wants the primers to create, and is a space separated list of elements of the form (x)-(y) where an (x)-(y) pair is a legal range of lengths for the product. For example, if one wants PCR products to be between 100 to 150 bases (inclusive) then one would set this parameter to 100-150. If one desires PCR products in either the range from 100 to 150 bases or in the range from 200 to 250 bases then one would set this parameter to 100-150 200-250. Primer3 favors ranges to the left side of the parameter string. Primer3 will return legal primers pairs in the first range regardless the value of the objective function for these pairs. Only if there are an insufficient number of primers in the first range will Primer3 return primers in a subsequent range. | Sequence range | 100-300 | ||||||||||
-productotm | The optimum melting temperature for the PCR product. 0 indicates that there is no optimum temperature. | Any integer value | 0.0 | ||||||||||
-productmintm | The minimum allowed melting temperature of the amplicon. Please see the documentation on the maximum melting temperature of the product for details. | Any integer value | -1000000.0 | ||||||||||
-productmaxtm | The maximum allowed melting temperature of the amplicon. Product Tm is calculated using the formula from Bolton and McCarthy, PNAS 84:1390 (1962) as presented in Sambrook, Fritsch and Maniatis, Molecular Cloning, p 11.46 (1989, CSHL Press). Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) - 600/length Where [Na+} is the molar sodium concentration, (%GC) is the percent of Gs and Cs in the sequence, and length is the length of the sequence. A similar formula is used by the prime primer selection program in GCG http://www.gcg.com), which instead uses 675.0/length in the last term (after F. Baldino, Jr, M.-F. Chesselet, and M.E. Lewis, Methods in Enzymology 168:766 (1989) eqn (1) on page 766 without the mismatch and formamide terms). The formulas here and in Baldino et al. assume Na+ rather than K+. According to J.G. Wetmur, Critical Reviews in BioChem. and Mol. Bio. 26:227 (1991) 50 mM K+ should be equivalent in these formulae to .2 M Na+. Primer3 uses the same salt concentration value for calculating both the primer melting temperature and the oligo melting temperature. If you are planning to use the PCR product for hybridization later this behavior will not give you the Tm under hybridization conditions. | Any integer value | 1000000.0 | ||||||||||
-oligoexcludedregion | Middle oligos may not overlap any region specified by this tag. The associated value must be a space-separated list of (start),(end) pairs, where (start) is the index of the first base of an excluded region, and (end) is the last. Often one would make Target regions excluded regions for internal oligos. | Sequence range | full sequence | ||||||||||
-oligoinput | The sequence of an internal oligo to check and around which to design forward and reverse primers. Must be a substring of SEQUENCE. | Any string is accepted | An empty string is accepted | ||||||||||
-oligoosize | Optimum length (in bases) of an internal oligo. Primer3 will attempt to pick primers close to this length. | Integer 0 or more | 20 | ||||||||||
-oligominsize | Minimum acceptable length of an internal oligo. Must be greater than 0 and less than or equal to INTERNAL-OLIGO-MAX-SIZE. | Integer 0 or more | 18 | ||||||||||
-oligomaxsize | Maximum acceptable length (in bases) of an internal oligo. Currently this parameter cannot be larger than 35. This limit is governed by maximum oligo size for which Primer3's melting-temperature is valid. | Integer up to 35 | 27 | ||||||||||
-oligootm | Optimum melting temperature (Celsius) for an internal oligo. Primer3 will try to pick oligos with melting temperatures that are close to this temperature. The oligo melting temperature formula in Primer3 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 12, pp 6409-6412 and Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for background discussion. | Any integer value | 60.0 | ||||||||||
-oligomintm | Minimum acceptable melting temperature(Celsius) for an internal oligo. | Any integer value | 57.0 | ||||||||||
-oligomaxtm | Maximum acceptable melting temperature (Celsius) for an internal oligo. | Any integer value | 63.0 | ||||||||||
-oligoogcpercent | Internal oligo optimum GC percent. | Any integer value | 50.0 | ||||||||||
-oligomingc | Minimum allowable percentage of Gs and Cs in an internal oligo. | Any integer value | 20.0 | ||||||||||
-oligomaxgc | Maximum allowable percentage of Gs and Cs in any internal oligo generated by Primer. | Any integer value | 80.0 | ||||||||||
-oligosaltconc | The millimolar concentration of salt (usually KCl) in the hybridization. Primer3 uses this argument to calculate internal oligo melting temperatures. | Any integer value | 50.0 | ||||||||||
-oligodnaconc | The nanomolar concentration of annealing internal oligo in the hybridization. | Any integer value | 50.0 | ||||||||||
-oligoselfany | The maximum allowable local alignment score when testing an internal oligo for (local) self-complementarity. Local self-complementarity is taken to predict the tendency of oligos to anneal to themselves The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment 5' ATCGNA 3' || | | 3' TA-CGT 5' is allowed (and yields a score of 1.75), but the alignment 5' ATCCGNA 3' || | | 3' TA--CGT 5' is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos. | Number up to 9999.990 | 12.00 | ||||||||||
-oligoselfend | The maximum allowable 3'-anchored global alignment score when testing a single oligo for self-complementarity. The scoring system is as for the Maximum Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate oligos, Primer assumes that the sequence from which to choose oligos is presented 5' to 3'. INTERNAL-OLIGO-SELF-END is meaningless when applied to internal oligos used for hybridization-based detection, since primer-dimer will not occur. We recommend that INTERNAL-OLIGO-SELF-END be set at least as high as INTERNAL-OLIGO-SELF-ANY. | Number up to 9999.990 | 12.00 | ||||||||||
-oligomaxpolyx | The maximum allowable length of an internal oligo mononucleotide repeat, for example AAAAAA. | Integer 0 or more | 5 | ||||||||||
Advanced qualifiers | Allowed values | Default | |||||||||||
-explainflag | If this flag is non-0, produce LEFT-EXPLAIN, RIGHT-EXPLAIN, and INTERNAL-OLIGO-EXPLAIN output tags, which are intended to provide information on the number of oligos and primer pairs that Primer3 examined, and statistics on the number discarded for various reasons. | Yes/No | No | ||||||||||
-fileflag | If the associated value is non-0, then Primer3 creates two output files for each input SEQUENCE. File (sequence-id).for lists all acceptable forward primers for (sequence-id), and (sequence-id).rev lists all acceptable reverse primers for (sequence-id), where (sequence-id) is the value of the SEQUENCE-ID tag (which must be supplied). In addition, if the input tag TASK is 1 or 4, Primer3 produces a file (sequence-id).int, which lists all acceptable internal oligos. | Yes/No | No | ||||||||||
-firstbaseindex | This parameter is the index of the first base in the input sequence. For input and output using 1-based indexing (such as that used in GenBank and to which many users are accustomed) set this parameter to 1. For input and output using 0-based indexing set this parameter to 0. (This parameter also affects the indexes in the contents of the files produced when the primer file flag is set.) | Any integer value | 1 | ||||||||||
-pickanyway | If true pick a primer pair even if LEFT-INPUT, RIGHT-INPUT, or INTERNAL-OLIGO-INPUT violates specific constraints. | Yes/No | No | ||||||||||
-mispriminglibrary | The name of a file containing a nucleotide sequence library of sequences to avoid amplifying (for example repetitive sequences, or possibly the sequences of genes in a gene family that should not be amplified.) The file must be in (a slightly restricted) FASTA format (W. B. Pearson and D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]); we briefly discuss the organization of this file below. If this parameter is specified then Primer3 locally aligns each candidate primer against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds MAX-MISPRIMING. (The maximum value of the weight is arbitrarily set to 100.0.) Each sequence entry in the FASTA-format file must begin with an 'id line' that starts with '>'. The contents of the id line is 'slightly restricted' in that Primer3 parses everything after any optional asterisk ('*') as a floating point number to use as the weight mentioned above. If the id line contains no asterisk then the weight defaults to 1.0. The alignment scoring system used is the same as for calculating complementarity among oligos (e.g. SELF-ANY). The remainder of an entry contains the sequence as lines following the id line up until a line starting with '>' or the end of the file. Whitespace and newlines are ignored. Characters 'A', 'T', 'G', 'C', 'a', 't', 'g', 'c' are retained and any other character is converted to 'N' (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to 'N'). There are no restrictions on line length. An empty value for this parameter indicates that no repeat library should be used. | Input file | Required | ||||||||||
-maxmispriming | The maximum allowed weighted similarity with any sequence in MISPRIMING-LIBRARY. | Number up to 9999.990 | 12.00 | ||||||||||
-pairmaxmispriming | The maximum allowed sum of weighted similarities of a primer pair (one similarity for each primer) with any single sequence in MISPRIMING-LIBRARY. | Number up to 9999.990 | 24.00 | ||||||||||
-numnsaccepted | Maximum number of unknown bases (N) allowable in any primer. | Integer 0 or more | 0 | ||||||||||
-selfany | The maximum allowable local alignment score when testing a single primer for (local) self-complementarity and the maximum allowable local alignment score when testing for complementarity between forward and reverse primers. Local self-complementarity is taken to predict the tendency of primers to anneal to each other without necessarily causing self-priming in the PCR. The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment 5' ATCGNA 3' ...|| | | 3' TA-CGT 5' is allowed (and yields a score of 1.75), but the alignment 5' ATCCGNA 3' ...|| | | 3' TA--CGT 5' is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos. | Number from 0.000 to 9999.990 | 8.00 | ||||||||||
-selfend | The maximum allowable 3'-anchored global alignment score when testing a single primer for self-complementarity, and the maximum allowable 3'-anchored global alignment score when testing for complementarity between forward and reverse primers. The 3'-anchored global alignment score is taken to predict the likelihood of PCR-priming primer-dimers, for example 5' ATGCCCTAGCTTCCGGATG 3' .............||| ||||| ..........3' AAGTCCTACATTTAGCCTAGT 5' or 5' AGGCTATGGGCCTCGCGA 3' ...............|||||| ............3' AGCGCTCCGGGTATCGGA 5' The scoring system is as for the Maximum Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate primers and primer pairs, Primer assumes that the sequence from which to choose primers is presented 5' to 3'. It is nonsensical to provide a larger value for this parameter than for the Maximum (local) Complementarity parameter because the score of a local alignment will always be at least as great as the score of a global alignment. | Number 0.000 or more | 3.00 | ||||||||||
-maxendstability | The maximum stability for the five 3' bases of a forward or reverse primer. Bigger numbers mean more stable 3' ends. The value is the maximum delta G for duplex disruption for the five 3' bases as calculated using the nearest neighbor parameters published in Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Primer3 uses a completely permissive default value for backward compatibility (which we may change in the next release). Rychlik recommends a maximum value of 9 (Wojciech Rychlik, 'Selection of Primers for Polymerase Chain Reaction' in BA White, Ed., 'Methods in Molecular Biology, Vol. 15: PCR Protocols: Current Methods and Applications', 1993, pp 31-40, Humana Press, Totowa NJ). | Number up to 1000.000 | 9.0 | ||||||||||
-oligomishyblibrary | Similar to MISPRIMING-LIBRARY, except that the event we seek to avoid is hybridization of the internal oligo to sequences in this library rather than priming from them. The file must be in (a slightly restricted) FASTA format (W. B. Pearson and D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]); we briefly discuss the organization of this file below. If this parameter is specified then Primer3 locally aligns each candidate oligo against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds INTERNAL-OLIGO-MAX-MISHYB. (The maximum value of the weight is arbitrarily set to 12.0.) Each sequence entry in the FASTA-format file must begin with an 'id line' that starts with '>'. The contents of the id line is 'slightly restricted' in that Primer3 parses everything after any optional asterisk ('*') as a floating point number to use as the weight mentioned above. If the id line contains no asterisk then the weight defaults to 1.0. The alignment scoring system used is the same as for calculating complementarity among oligos (e.g. SELF-ANY). The remainder of an entry contains the sequence as lines following the id line up until a line starting with '>' or the end of the file. Whitespace and newlines are ignored. Characters 'A', 'T', 'G', 'C', 'a', 't', 'g', 'c' are retained and any other character is converted to 'N' (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to 'N'). There are no restrictions on line length. An empty value for this parameter indicates that no library should be used. | Input file | Required | ||||||||||
-oligomaxmishyb | Similar to MAX-MISPRIMING except that this parameter applies to the similarity of candidate internal oligos to the library specified in INTERNAL-OLIGO-MISHYB-LIBRARY. | Number up to 9999.990 | 12.0 |
# PRIMER3 RESULTS FOR HSFAU1 # FORWARD PRIMER STATISTICS: # considered 18855 # GC content failed 156 # low tm 3616 # high tm 11295 # high any compl 1 # high end compl 1 # long poly-x seq 45 # ok 3741 # REVERSE PRIMER STATISTICS: # considered 18706 # GC content failed 161 # low tm 3580 # high tm 11241 # long poly-x seq 66 # ok 3658 # PRIMER PAIR STATISTICS: # considered 188 # unacceptable product size 169 # high end compl 4 # ok 15 # Start Len Tm GC% Sequence 1 PRODUCT SIZE: 289 FORWARD PRIMER 1725 20 59.96 55.00 AGGGAAGGGATGCTAGGTGT REVERSE PRIMER 1994 20 59.99 55.00 AGAAGCACACCTCTCCCTGA 2 PRODUCT SIZE: 290 FORWARD PRIMER 1725 20 59.96 55.00 AGGGAAGGGATGCTAGGTGT REVERSE PRIMER 1995 20 59.99 60.00 GAGAAGCACACCTCTCCCTG 3 PRODUCT SIZE: 288 FORWARD PRIMER 1725 20 59.96 55.00 AGGGAAGGGATGCTAGGTGT REVERSE PRIMER 1993 20 59.99 60.00 GAAGCACACCTCTCCCTGAG 4 PRODUCT SIZE: 286 FORWARD PRIMER 1728 20 60.07 55.00 GAAGGGATGCTAGGTGTGGA REVERSE PRIMER 1994 20 59.99 55.00 AGAAGCACACCTCTCCCTGA 5 PRODUCT SIZE: 284 FORWARD PRIMER 1731 20 60.07 55.00 GGGATGCTAGGTGTGGAAGA REVERSE PRIMER 1995 20 59.99 60.00 GAGAAGCACACCTCTCCCTG
If the '-explain' flag has been used, as in the example, then statistics are output describing the number of primers that were considered and rejected for various reasons.
Headers describing the input file name and the names of the output columns are displayed.
The best 5 primer pairs are displayed with the product size.
The reverse sequence is displayed as the reverse complement to the input forward sense sequence.
The 'Start' positions are given counting from the start of the sequence for both the forward and reverse primer (and for the internal oligos).
Note that if you compare the results to the output from the public Primer3 web site you will see a difference in the reverse primer positions - this is because the original Primer3 program reports the reverse primer positions as couted from the 3' end. The convention in EMBOSS is to report both forward and reverse featyres as counted from the 5' end, so the reverse primer positions are given counted from the 5' start of the sequence.
The version that is run by this program is 3.0.9 currently available from: http://www-genome.wi.mit.edu/ftp/distribution/software/primer3_0_9_test.tar.gz
Program name | Description |
---|---|
prima | Selects primers for PCR and DNA amplification |
primersearch | Searches DNA sequences for matches with primer pairs |
stssearch | Searches a DNA database for matches with a set of STS primers |
The Whitehead Institute's primer3 program is not part of this program, but it must be set up on your system and on your path.
The Whitehead Institute's primer3 program is:
Copyright (c) 1996,1997,1998
Whitehead Institute for Biomedical Research. All rights reserved.
The Whitehead Institute requests that use of this software be cited in publications as:
Steve Rozen, Helen J. Skaletsky (1996,1997,1998)
Primer3. Code available at
http://www-genome.wi.mit.edu/genome_software/other/primer3.html