![]() |
EMBOSS: prima |
In selecting appropriate primers, prima considers a variety of constraints on the primer and amplified product sequences. You either can use the program's default constraint values or modify those values to customize the analysis. You can specify upper and lower limits for primer and product melting temperatures and for primer and product GC contents. For primers, you can specify a range of acceptable primer sizes, any required bases at the 3' end of the primer (3' clamp), and a maximum difference in primer melting temperatures for PCR primer pairs. For PCR products, you can specify a range of acceptable product sizes.
The terms forward primer and reverse primer are used in the remainder of this document and in the program output. Forward primers are complementary to sequences on the reverse template strand and create copies of the forward strand by primer extension. Conversely, reverse primers are complementary to sequences on the forward template strand and create copies of the reverse strand by primer extension.
The name prima is a truly European one. In searching for yet another primer program name, we discovered that not only can "prima" be pronounced in English as "Primer", but it has additional meanings in other languages. In Italian it means "first", in German it means "super", and in Spanish it means "cousin".
% prima Input sequence: embl:eclaci Specify a Target Range? [N]: Minimum Primer Tm (deg Celsius) [53]: Maximum Primer Tm (deg Celsius) [58]: Minimum product length [100]: Maximum product length [300]: Output file [eclaci.prima]:
Mandatory qualifiers (* if not always prompted): [-sequence] sequence Sequence USA [-targetrange] bool Specify a Target Range? * -targetstart integer Target start position. * -targetend integer Target end position. -minprimertm float Minimum Primer Tm (deg Celsius) -maxprimertm float Maximum Primer Tm (deg Celsius) * -minprodlen integer Minimum product length * -maxprodlen integer Maximum product length [-outf] outfile Output file name Optional qualifiers: (none) Advanced qualifiers: -overlap integer Minimum overlap of sequences -minprimerlen integer Minimum primer length -maxprimerlen integer Maximum primer length -minpmgccont float Minimum primer GC fraction -maxpmgccont float Maximum primer GC fraction -minprodgccont float Minimum product GC fraction -maxprodgccont float Maximum product GC fraction -saltconc float Salt concentration (mM) -dnaconc float DNA concentration (mM) -list bool Force list-style output General qualifiers: -help bool report command line options. More information on associated and general qualifiers can be found with -help -verbose |
Mandatory qualifiers | Allowed values | Default | |
---|---|---|---|
[-sequence] (Parameter 1) |
Sequence USA | Readable sequence | Required |
[-targetrange] (Parameter 2) |
Specify a Target Range? | Yes/No | No |
-targetstart | Target start position. | Any integer value | Start of sequence |
-targetend | Target end position. | Any integer value | End of sequence |
-minprimertm | Minimum Primer Tm (deg Celsius) | Any integer value | 53 |
-maxprimertm | Maximum Primer Tm (deg Celsius) | Any integer value | 58 |
-minprodlen | Minimum product length | Any integer value | 100 |
-maxprodlen | Maximum product length | Any integer value | 300 |
[-outf] (Parameter 3) |
Output file name | Output file | <sequence>.prima |
Optional qualifiers | Allowed values | Default | |
(none) | |||
Advanced qualifiers | Allowed values | Default | |
-overlap | Minimum overlap of sequences | Any integer value | 50 |
-minprimerlen | Minimum primer length | Any integer value | 18 |
-maxprimerlen | Maximum primer length | Any integer value | 22 |
-minpmgccont | Minimum primer GC fraction | Number from 0.300 to 0.700 | .40 |
-maxpmgccont | Maximum primer GC fraction | Number from 0.300 to 0.700 | .55 |
-minprodgccont | Minimum product GC fraction | Number from 0.300 to 0.700 | .40 |
-maxprodgccont | Maximum product GC fraction | Number from 0.300 to 0.700 | .55 |
-saltconc | Salt concentration (mM) | Number from 1.000 to 100.000 | 50 |
-dnaconc | DNA concentration (mM) | Number from 1.000 to 100.000 | 50 |
-list | Force list-style output | Yes/No | No |
INPUT SUMMARY ************* Prima of ECLACI PRIMER CONSTRAINTS: PRIMA DOES NOT ALLOW PRIMER SEQUENCE AMBIGUITY OR DUPLICATE PRIMER ENDPOINTS Primer size range is 18-22 Primer GC content range is 0.40-0.55 Primer melting Temp range is 53.00 - 58.00 C PRODUCT CONSTRAINTS: Product GC content range is 0.40-0.55 Salt concentration is 50.00 (mM) DNA concentration is 50.00 (nM) Considering all suitable Primer pairs with Product length ranges 100 to 300 PRIMER/PRODUCT PAIR CALCULATIONS & OUTPUT ***************************************** 3 pairs found Forward Reverse [1] 10 AGTCAATTCAGGGTGGTGAA 29 154 ATGTAATTCAGCTCCGCCAT 173 Tm 56.24 C (GC 50.00%) Tm 57.14 C (GC 50.00%) Length: 20 Length: 20 Tma: 40.56 C Tma: 40.83 C Product GC: 53.23% Product Tm: 55.12 C Length: 124 [2] 266 TTGTCGCGGCGATTAAATCTC 286 510 GTACCGTCTTCATGGGAGAAA 530 Tm 57.88 C (GC 42.86%) Tm 55.78 C (GC 42.86%) Length: 21 Length: 21 Tma: 42.45 C Tma: 41.82 C Product GC: 54.71% Product Tm: 57.13 C Length: 223 [3] 477 TGTCTCTGACCAGACACCC 495 728 GGAACGATGCCCTCATTCA 746 Tm 54.99 C (GC 52.63%) Tm 55.20 C (GC 52.63%) Length: 19 Length: 19 Tma: 42.28 C Tma: 42.34 C Product GC: 53.02% Product Tm: 58.12 C Length: 232The output file begins with a summary listing all of the constraints used by the program to select appropriate primers or PCR primer pairs. Most of these constraints can be modified by adjusting prompted and optional program parameters.
Following these summaries is an ordered listing of the most appropriate primers or PCR primer pairs selected by prima. The list is ordered by total annealing score so that those primers or PCR primer pairs with the least amount of complementarity to sequences other than the appropriate primer binding sites are listed first. Each output primer or PCR primer pair is designated by a number that corresponds to a line number in the plot of primer sites. While the text output file lists the location of the primer binding site along with each primer sequence, the plot provides a convenient way to review the primer binding sites of many of the selected primers at once.
Program name | Description |
---|---|
primer3 | Picks PCR primers and hybridization oligos |
primersearch | Searches DNA sequences for matches with primer pairs |
stssearch | Searches a DNA database for matches with a set of STS primers |