![]() |
EMBOSS: prettyseq |
The translated nucleic acid region will be shown in lower-case letters while the rest of the input sequence will be left in the input case.
The base and residue numbers of the sequences are shown beside the sequences in the output.
Slightly unusually, this application uses the codon usage tables to translate the codons.
% prettyseq Output sequence with translated ranges Input sequence: embl:paamir Range(s) to translate [1-2167]: 135-1292 Output file [paamir.prettyseq]:
Mandatory qualifiers: [-sequence] sequence Sequence USA -range range Range(s) to translate [-outfile] outfile Output file name Optional qualifiers: -[no]ruler bool Add a ruler -[no]plabel bool Number translations -[no]nlabel bool Number DNA sequence Advanced qualifiers: -cfile codon Codon usage file -width integer Width of screen General qualifiers: -help bool report command line options. More information on associated and general qualifiers can be found with -help -verbose |
Mandatory qualifiers | Allowed values | Default | |
---|---|---|---|
[-sequence] (Parameter 1) |
Sequence USA | Readable sequence | Required |
-range | Range(s) to translate | Sequence range | Whole sequence |
[-outfile] (Parameter 2) |
Output file name | Output file | <sequence>.prettyseq |
Optional qualifiers | Allowed values | Default | |
-[no]ruler | Add a ruler | Yes/No | Yes |
-[no]plabel | Number translations | Yes/No | Yes |
-[no]nlabel | Number DNA sequence | Yes/No | Yes |
Advanced qualifiers | Allowed values | Default | |
-cfile | Codon usage file | Codon usage file in EMBOSS data path | Ehum.cut |
-width | Width of screen | Integer 10 or more | 60 |
The format of the range file is:
An example range file is:
# this is my set of ranges 12 23 4 5 this is like 12-23, but smaller 67 10348 interesting region
PRETTYSEQ of PAAMIR from 1 to 2167 ---------|---------|---------|---------|---------|---------| 1 GGTACCGCTGGCCGAGCATCTGCTCGATCACCACCAGCCGGGCGACGGGAACTGCACGAT 60 ---------|---------|---------|---------|---------|---------| 61 CTACCTGGCGAGCCTGGAGCACGAGCGGGTTCGCTTCGTACGGCGCTGAGCGACAGTCAC 120 ---------|---------|---------|---------|---------|---------| 121 AGGAGAGGAAACGGatgggatcgcaccaggagcggccgctgatcggcctgctgttctccg 180 1 M G S H Q E R P L I G L L F S E 16 ---------|---------|---------|---------|---------|---------| 181 aaaccggcgtcaccgccgatatcgagcgctcgcacgcgtatggcgcattgctcgcggtcg 240 17 T G V T A D I E R S H A Y G A L L A V E 36 ---------|---------|---------|---------|---------|---------| 241 agcaactgaaccgcgagggcggcgtcggcggtcgcccgatcgaaacgctgtcccaggacc 300 37 Q L N R E G G V G G R P I E T L S Q D P 56 ---------|---------|---------|---------|---------|---------| 301 ccggcggcgacccggaccgctatcggctgtgcgccgaggacttcattcgcaaccgggggg 360 57 G G D P D R Y R L C A E D F I R N R G V 76 ---------|---------|---------|---------|---------|---------| 361 tacggttcctcgtgggctgctacatgtcgcacacgcgcaaggcggtgatgccggtggtcg 420 77 R F L V G C Y M S H T R K A V M P V V E 96 ---------|---------|---------|---------|---------|---------| 421 agcgcgccgacgcgctgctctgctacccgaccccctacgagggcttcgagtattcgccga 480 97 R A D A L L C Y P T P Y E G F E Y S P N 116 ---------|---------|---------|---------|---------|---------| 481 acatcgtctacggcggtccggcgccgaaccagaacagtgcgccgctggcggcgtacctga 540 117 I V Y G G P A P N Q N S A P L A A Y L I 136 ---------|---------|---------|---------|---------|---------| 541 ttcgccactacggcgagcgggtggtgttcatcggctcggactacatctatccgcgggaaa 600 137 R H Y G E R V V F I G S D Y I Y P R E S 156 ---------|---------|---------|---------|---------|---------| 601 gcaaccatgtgatgcgccacctgtatcgccagcacggcggcacggtgctcgaggaaatct 660 157 N H V M R H L Y R Q H G G T V L E E I Y 176 ---------|---------|---------|---------|---------|---------| 661 acattccgctgtatccctccgacgacgacttgcagcgcgccgtcgagcgcatctaccagg 720 177 I P L Y P S D D D L Q R A V E R I Y Q A 196 ---------|---------|---------|---------|---------|---------| 721 cgcgcgccgacgtggtcttctccaccgtggtgggcaccggcaccgccgagctgtatcgcg 780 197 R A D V V F S T V V G T G T A E L Y R A 216 ---------|---------|---------|---------|---------|---------| 781 ccatcgcccgtcgctacggcgacggcaggcggccgccgatcgccagcctgaccaccagcg 840 217 I A R R Y G D G R R P P I A S L T T S E 236 ---------|---------|---------|---------|---------|---------| 841 aggcggaggtggcgaagatggagagtgacgtggcagaggggcaggtggtggtcgcgcctt 900 237 A E V A K M E S D V A E G Q V V V A P Y 256 ---------|---------|---------|---------|---------|---------| 901 acttctccagcatcgatacgcccgccagccgggccttcgtccaggcctgccatggtttct 960 257 F S S I D T P A S R A F V Q A C H G F F 276 ---------|---------|---------|---------|---------|---------| 961 tcccggagaacgcgaccatcaccgcctgggccgaggcggcctactggcagaccttgttgc 1020 277 P E N A T I T A W A E A A Y W Q T L L L 296 ---------|---------|---------|---------|---------|---------| 1021 tcggccgcgccgcgcaggccgcaggcaactggcgggtggaagacgtgcagcggcacctgt 1080 297 G R A A Q A A G N W R V E D V Q R H L Y 316 ---------|---------|---------|---------|---------|---------| 1081 acgacatcgacatcgacgcgccacaggggccggtccgggtggagcgccagaacaaccaca 1140 317 D I D I D A P Q G P V R V E R Q N N H S 336 ---------|---------|---------|---------|---------|---------| 1141 gccgcctgtcttcgcgcatcgcggaaatcgatgcgcgcggcgtgttccaggtccgctggc 1200 337 R L S S R I A E I D A R G V F Q V R W Q 356 ---------|---------|---------|---------|---------|---------| 1201 agtcgcccgaaccgattcgccccgacccttatgtcgtcgtgcataacctcgacgactggt 1260 357 S P E P I R P D P Y V V V H N L D D W S 376 ---------|---------|---------|---------|---------|---------| 1261 ccgccagcatgggcgggggaccgctcccatgaGCGCCAACTCGCTGCTCGGCAGCCTGCG 1320 377 A S M G G G P L P * 385 ---------|---------|---------|---------|---------|---------| 1321 CGAGTTGCAGGTGCTGGTCCTCAACCCGCCGGGGGAGGTCAGCGACGCCCTGGTCTTGCA 1380 ---------|---------|---------|---------|---------|---------| 1381 GCTGATCCGCATCGGTTGTTCGGTGCGCCAGTGCTGGCCGCCGCCGGAAGCCTTCGACGT 1440 ---------|---------|---------|---------|---------|---------| 1441 GCCGGTGGACGTGGTCTTCACCAGCATTTTCCAGAATGGCCACCACGACGAGATCGCTGC 1500 ---------|---------|---------|---------|---------|---------| 1501 GCTGCTCGCCGCCGGGACTCCGCGCACTACCCTGGTGGCGCTGGTGGAGTACGAAAGCCC 1560 ---------|---------|---------|---------|---------|---------| 1561 CGCGGTGCTCTCGCAGATCATCGAGCTGGAGTGCCACGGCGTGATCACCCAGCCGCTCGA 1620 ---------|---------|---------|---------|---------|---------| 1621 TGCCCACCGGGTGCTGCCTGTGCTGGTATCGGCGCGGCGCATCAGCGAGGAAATGGCGAA 1680 ---------|---------|---------|---------|---------|---------| 1681 GCTGAAGCAGAAGACCGAGCAGCTCCAGGACCGCATCGCCGGCCAGGCCCGGATCAACCA 1740 ---------|---------|---------|---------|---------|---------| 1741 GGCCAAGGTGTTGCTGATGCAGCGCCATGGCTGGGACGAGCGCGAGGCGCACCAGCACCT 1800 ---------|---------|---------|---------|---------|---------| 1801 GTCGCGGGAAGCGATGAAGCGGCGCGAGCCGATCCTGAAGATCGCTCAGGAGTTGCTGGG 1860 ---------|---------|---------|---------|---------|---------| 1861 AAACGAGCCGTCCGCCTGAGCGATCCGGGCCGACCAGAACAATAACAAGAGGGGTATCGT 1920 ---------|---------|---------|---------|---------|---------| 1921 CATCATGCTGGGACTGGTTCTGCTGTACGTTGGCGCGGTGCTGTTTCTCAATGCCGTCTG 1980 ---------|---------|---------|---------|---------|---------| 1981 GTTGCTGGGCAAGATCAGCGGTCGGGAGGTGGCGGTGATCAACTTCCTGGTCGGCGTGCT 2040 ---------|---------|---------|---------|---------|---------| 2041 GAGCGCCTGCGTCGCGTTCTACCTGATCTTTTCCGCAGCAGCCGGGCAGGGCTCGCTGAA 2100 ---------|---------|---------|---------|---------|---------| 2101 GGCCGGAGCGCTGACCCTGCTATTCGCTTTTACCTATCTGTGGGTGGCCGCCAACCAGTT 2160 ------- 2161 CCTCGAG 2167
To see the available EMBOSS codon usage files, run:
% embossdata -showall
To fetch one of the codon usage tables (for example 'Emus.cut') into your current directory for you to inspect or modify, run:
% embossdata -fetch -file Emus.cut
Program name | Description |
---|---|
abiview | Reads ABI file and display the trace |
backtranseq | Back translate a protein sequence |
cirdna | Draws circular maps of DNA constructs |
coderet | Extract CDS, mRNA and translations from feature tables |
lindna | Draws linear maps of DNA constructs |
pepnet | Displays proteins as a helical net |
pepwheel | Shows protein sequences as helices |
plotorf | Plot potential open reading frames |
prettyplot | Displays aligned sequences, with colouring and boxing |
remap | Display a sequence with restriction cut sites, translation etc |
seealso | Finds programs sharing group names |
showalign | Display a multiple sequence alignment |
showdb | Displays information on the currently available databases |
showfeat | Show features of a sequence |
showorf | Pretty output of DNA translations |
showseq | Display a sequence with features, translation etc |
textsearch | Search sequence documentation text. SRS and Entrez are faster! |
transeq | Translate nucleic acid sequences |
showseq has more options for specifying various ways of displaying a sequence, with or without various ways of translating it.