vrnainverse

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

RNA sequences matching a structure

Description

This is a port of the Vienna RNA package program RNAinverse.

Algorithm

See the original documentation for the Vienna RNA package http://www.tbi.univie.ac.at/~ivo/RNA/

Usage

Here is a sample session with vrnainverse


% vrnainverse -repeats 3 
RNA sequences matching a structure
Vienna RNA structures file: rna3.fold
Vienna RNAfold output file [rna3.vrnainverse]: 

Go to the input files for this example
Go to the output files for this example

Example 2


% vrnainverse -repeats 3 -succeed 
RNA sequences matching a structure
Vienna RNA structures file: rna3.fold
Vienna RNAfold output file [rna3.vrnainverse]: 

Go to the output files for this example

Command line arguments

RNA sequences matching a structure
Version: EMBOSS:6.2.0

   Standard (Mandatory) qualifiers:
  [-structuresfile]    infile     Vienna RNA structures file
  [-outfile]           outfile    [*.vrnainverse] Vienna RNAfold output file

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers:
   -sequence           sequence   Nucleotide sequence filename and optional
                                  format, or reference (input USA)
   -paramfile          infile     Vienna RNA parameters file (optional)
   -temperature        float      [37.0] Temperature (Any numeric value)
   -[no]gu             boolean    [Y] Allow GU pairs
   -[no]closegu        boolean    [Y] Allow GU pairs at end of helices
   -[no]lp             boolean    [Y] Allow lonely pairs
   -[no]convert        boolean    [Y] Convert T to U
   -nsbases            string     Non-standard bases (Any string)
   -[no]tetraloop      boolean    [Y] Stabilizing energies for tetra-loops
   -energy             menu       [0] Rarely used option to fold sequences
                                  from the ABCD... alphabet (Values: 0 (BP); 1
                                  (Any with GC); 2 (Any with AU parameters))
   -dangles            menu       [1] Method (Values: 0 (Ignore); 1 (Only
                                  unpaired bases for just one dangling end); 2
                                  (Always use dangling energies); 3 (Allow
                                  coaxial stacking of adjacent helices))
   -folding            menu       [m] Method (Values: m (Minimum energy); pv
                                  (Partition function); mp (Both))
   -alphabet           string     [AUGC] Find sequences using only these bases
                                  (Any string)
   -final              float      [0.0] Stopping value (Any numeric value)
   -repeats            integer    [0] Number of times to search for the same
                                  structure (Integer 0 or more)
   -succeed            boolean    [N] The original RNAinverse uses a negative
                                  repeat for this
   -showfails          boolean    [N] Show information for unsuccessful
                                  searches

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin             integer    Start of the sequence to be used
   -send               integer    End of the sequence to be used
   -sreverse           boolean    Reverse (if DNA)
   -sask               boolean    Ask for begin/end/reverse
   -snucleotide        boolean    Sequence is nucleotide
   -sprotein           boolean    Sequence is protein
   -slower             boolean    Make lower case
   -supper             boolean    Make upper case
   -sformat            string     Input sequence format
   -sdbname            string     Database name
   -sid                string     Entryname
   -ufo                string     UFO features
   -fformat            string     Features format
   -fopenfile          string     Features file name

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-structuresfile]
(Parameter 1)
infile Vienna RNA structures file Input file Required
[-outfile]
(Parameter 2)
outfile Vienna RNAfold output file Output file <*>.vrnainverse
Additional (Optional) qualifiers
(none)
Advanced (Unprompted) qualifiers
-sequence sequence Nucleotide sequence filename and optional format, or reference (input USA) Readable sequence Required
-paramfile infile Vienna RNA parameters file (optional) Input file Required
-temperature float Temperature Any numeric value 37.0
-[no]gu boolean Allow GU pairs Boolean value Yes/No Yes
-[no]closegu boolean Allow GU pairs at end of helices Boolean value Yes/No Yes
-[no]lp boolean Allow lonely pairs Boolean value Yes/No Yes
-[no]convert boolean Convert T to U Boolean value Yes/No Yes
-nsbases string Non-standard bases Any string  
-[no]tetraloop boolean Stabilizing energies for tetra-loops Boolean value Yes/No Yes
-energy list Rarely used option to fold sequences from the ABCD... alphabet
0 (BP)
1 (Any with GC)
2 (Any with AU parameters)
0
-dangles list Method
0 (Ignore)
1 (Only unpaired bases for just one dangling end)
2 (Always use dangling energies)
3 (Allow coaxial stacking of adjacent helices)
1
-folding list Method
m (Minimum energy)
pv (Partition function)
mp (Both)
m
-alphabet string Find sequences using only these bases Any string AUGC
-final float Stopping value Any numeric value 0.0
-repeats integer Number of times to search for the same structure Integer 0 or more 0
-succeed boolean The original RNAinverse uses a negative repeat for this Boolean value Yes/No No
-showfails boolean Show information for unsuccessful searches Boolean value Yes/No No
Associated qualifiers
"-sequence" associated sequence qualifiers
-sbegin integer Start of the sequence to be used Any integer value 0
-send integer End of the sequence to be used Any integer value 0
-sreverse boolean Reverse (if DNA) Boolean value Yes/No N
-sask boolean Ask for begin/end/reverse Boolean value Yes/No N
-snucleotide boolean Sequence is nucleotide Boolean value Yes/No N
-sprotein boolean Sequence is protein Boolean value Yes/No N
-slower boolean Make lower case Boolean value Yes/No N
-supper boolean Make upper case Boolean value Yes/No N
-sformat string Input sequence format Any string  
-sdbname string Database name Any string  
-sid string Entryname Any string  
-ufo string UFO features Any string  
-fformat string Features format Any string  
-fopenfile string Features file name Any string  
"-outfile" associated outfile qualifiers
-odirectory2
-odirectory_outfile
string Output directory Any string  
General qualifiers
-auto boolean Turn off prompts Boolean value Yes/No N
-stdout boolean Write first file to standard output Boolean value Yes/No N
-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N
-options boolean Prompt for standard and additional values Boolean value Yes/No N
-debug boolean Write debug output to program.dbg Boolean value Yes/No N
-verbose boolean Report some/full command line options Boolean value Yes/No Y
-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N
-warning boolean Report warnings Boolean value Yes/No Y
-error boolean Report errors Boolean value Yes/No Y
-fatal boolean Report fatal errors Boolean value Yes/No Y
-die boolean Report dying program messages Boolean value Yes/No Y
-version boolean Report version number and exit Boolean value Yes/No N

Input file format

vrnainverse reads any normal sequence USAs.

Input files for usage example

File: rna3.fold

(((((((..((((........)))).(((((.......))))).....(((((.......))))))))))))....

Output file format

vrnainverse outputs a graph to the specified graphics device. outputs a report format file. The default format is ...

Output files for usage example

File: rna3.vrnainverse

UGUUUUAUUGGUCUCGUCGCUGACCUGGGUGUAUCGAUCAUCUUGUACGGGCUCCAAGCGGGUUCUAGGACACACU   28   d = 1.000000
UCCUUUAUCGCAGAUACAGCCCUGCCCAUGUUAGCCACACAUGCGAUUCACCAUUCCGACUGGUGUAGAGGGUGCG   27
GUUAUUUAUGCGGCAGGACCACCGCGGAGUAGUUCUUAUAUUCACACACUGGUAUUUGCGACCGGGAGUAGCGGCC   19

Output files for usage example 2

File: rna3.vrnainverse

UAUGUGUGUCUGCUUUAACCCGCAGCAACCGGGAUCGACGGUUAUAUGUUUGAUUAACGUUCAAAGCACAUGGUGA   25
GUUGUGAAAGCACAACCUAACGUGCCCUGUGAUCGAUACAUAGUAGUAUGCAAACCACCCUUGUAUCGCGACCUGC   31
GUGAAUUGAGGCGACGAGGUAUGCUAGGGGCCCAACAAGCCCCAACUCCCGCGGCCCUUACGUGGAGUUCAUAUUA   21

Data files

For details of Vienna RNA file formats, see the original documentation http://www.tbi.univie.ac.at/~ivo/RNA/

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with status 0.

Known bugs

None.

See also

Program name Description
einverted Finds inverted repeats in nucleotide sequences
vrnaalifold RNA alignment folding
vrnaalifoldpf RNA alignment folding with partition
vrnacofold RNA cofolding
vrnacofoldconc RNA cofolding with concentrations
vrnacofoldpf RNA cofolding with partitioning
vrnadistance RNA distances
vrnaduplex RNA duplex calculation
vrnaeval RNA eval
vrnaevalpair RNA eval with cofold
vrnafold Calculate secondary structures of RNAs
vrnafoldpf Secondary structures of RNAs with partition
vrnaheat RNA melting
vrnalfold Calculate locally stable secondary structures of RNAs
vrnaplot Plot vrnafold output
vrnasubopt Calculate RNA suboptimals

Author(s)

This program is an EMBOSS conversion of a program written by Ivo Hofacker as part of his VIENNA package.

Although we take every care to ensure that the results of the EMBOSS version are identical to those from the original package, we recommend that you check your inputs give the same results in both versions before publication.

Please report all bugs in the EMBOSS version to the EMBOSS bug team, not to the original author.

History

Converted (October 2005) by Alan Bleasby

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments